Warning: fopen(/home/virtual/epih/journal/upload/ip_log/ip_log_2026-03.txt): failed to open stream: Permission denied in /home/virtual/lib/view_data.php on line 95 Warning: fwrite() expects parameter 1 to be resource, boolean given in /home/virtual/lib/view_data.php on line 96 No Association Between Functional Polymorphisms in COMT and MTHFR and Schizophrenia Risk in Korean Population
Skip Navigation
Skip to contents

Epidemiol Health : Epidemiology and Health

OPEN ACCESS
SEARCH
Search

Articles

Page Path
HOME > Epidemiol Health > Volume 32; 2010 > Article
Original Article
No Association Between Functional Polymorphisms in COMT and MTHFR and Schizophrenia Risk in Korean Population
Ho Jin Kang1, Byeong Moo Choe2, Seong Hwan Kim2, Seung-Rak Son2, Kyoung-Mu Lee3, Byoung Gwon Kim1, Young-Seoub Hong1
Epidemiol Health 2010;32:e2010011.
DOI: https://doi.org/10.4178/epih/e2010011
Published online: December 24, 2010

1Department of Preventive Medicine, Dong-A University School of Medicine, Busan, Korea.

2Department of Psychiatry, Dong-A University School of Medicine, Busan, Korea.

3Department of Environmental Health, Korea Open University, Seoul, Korea.

Correspondence: Young-Seoub Hong, MD. Department of Preventive Medicine, Dong-A University School of Medicine, 3-1 Dongdaesin-dong, Seo-gu, Busan 602-715, Korea. Tel: +82-51-240-2888, Fax: +82-51-253-5729, yshong@dau.ac.kr
• Received: September 14, 2010   • Accepted: December 2, 2010

© 2010, Korean Society of Epidemiology

This is an open-access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

prev next
  • 30,358 Views
  • 132 Download
  • 14 Crossref
  • OBJECTIVES
    Common genetic SNPs in two genes, encoding catechol-O-methyltransferase (COMT) and methylenetetrahydrofolate reductase (MTHFR), which are interconnected with COMT gene regulation, have been reported to contribute to schizophrenia risk. In this study, we evaluated the association between functional polymorphisms in COMT and MTHFR and schizophrenia risk with a case-control study in a Korean population.
  • METHODS
    We performed a case-control study by genotyping analysis using 360 cases and 348 controls in Korean subjects to determine the association between functional polymorphisms in COMT and MTHFR and schizophrenia risk.
  • RESULTS
    Four functional SNPs in COMT (Val158Met and rs165599) and MTHFR (C677T and A1298C) were genotyped by primer extension assay. None of the genotype distributions for the four SNPs was significantly different between cases and controls. Stratified analysis did not show any significant gender difference for any polymorphism. In addition, we found no evidence of a gene-gene interaction in the analysis of combined genotypes.
  • CONCLUSION
    Our results suggest no significant association between the selected functional polymorphisms of COMT or MTHFR in Korean schizophrenia subjects. However, further studies are required to confirm our findings in a larger number of subjects.
Schizophrenia is a complex disorder involving multiple genetic and environmental factors [1]. Despite accumulating evidence suggesting that the etiology of schizophrenia includes a highly heritable component [2], the specific genetic loci and neurobiological mechanisms that contribute to the disorder remain unclear.
A number of studies have evaluated the association between the Val108/158Met polymorphism (rs4680) in the COMT gene, encoding catechol-O-methyltransferase, which catalyzes the metabolism of dopamine, and schizophrenia risk. Although several functional studies have shown that patients with the Val/Val genotype had better executive function and working memory compared to Met allele carriers [3, 4], recent metaanalyses could not replicate the association in either European or Asian populations [5-7]. Another variant in the 3' untranslated region (rs165599) in the COMT gene, which was highly associated with schizophrenia in a large study conducted in a population of Israelis of Ashkenazi descent [8], has been reported to differentially affect the expression of Val108/158Met alleles in human brain tissue [9].
The MTHFR gene, encoding methylenetetrahydrofolate reductase, which plays an important role in folate metabolism [10], is known to have two single nucleotide polymorphisms (SNPs; C677T and A1298C) affecting enzyme activity [11, 12]. The MTHFR 677T variant showed a 35% reduction in MTHFR activity such as DNA methylation [13, 14]. A recent meta-analysis supports the association between MTHFR C677T and A1298C SNPs and the development of schizophrenia [15-18].
The metabolic pathways of COMT and MTHFR are interconnected [19]. Genetic variation in MTHFR could influence the expression of COMT function through DNA methylation of the COMT promoter region [20]. COMT promoter methylation deficits have been described in schizophrenia, with concordant increases in COMT expression [21]. It has been suggested that abnormal methylation contributes to executive dysfunction in schizophrenia and other psychiatric disorders through downstream effects on dopamine signaling [22].
In the present study, we examined the relationship between functional polymorphisms in COMT and MTHFR polymorphisms and schizophrenia risk. We also investigated the effect of the combined genotypes of COMT and MTHFR polymorphisms.
Study subjects
A total of 360 patients with chronic schizophrenia and 348 healthy controls matched by age and sex were recruited from the inpatient and outpatient clinical services of the Department of Psychiatry, Dong-A University Hospital and other university-affiliated hospitals of Busan City Psychiatric Center. Schizophrenia was diagnosed on the basis of a clinical interview, using the Comprehensive Assessment of Symptoms and History (CASH) [23]. All patients met the DSM-IV criteria for schizophrenia [24]. The DSM-IV-diagnosed schizophrenic patients were recruited to the study between Jan 2003 and Dec 2009 from the inpatient population. Patients were selected according to strict criteria and those with both a current and past history of aggressive behavior. Healthy adult Korean volunteers were recruited as controls from among the residents of Busan when receiving health checkups. They had no reported current or past history of psychiatric disorders, including significant violent episodes. The demographic data for the case-control study is as follows: 54% male cases and 56% male controls (p=0.948), with a mean age of 38.32±3.93 yr for the cases and 38.26±5.51 for the controls (p=0.866). This study design was approved by the Committee on Human Research of the Dong-A University Hospital (Dong-A University IRB 07-18) and written informed consent was obtained from all participants or their legal guardians.
DNA extraction and COMT/MTHFR genotyping
Blood samples were collected in tubes that contained EDTA. Genomic DNA was extracted from white blood cell fractions by means of a Qiagen blood kit (Qiagen, Chatsworth, CA, USA). All four SNPs selected in this study were genotyped by SNP-IT™ assays using the SNPstream 25K™ System, which has been customized to perform fully automated genotyping using samples in 384-well plates with a colorimetric readout (Orchid Biosciences, New Jersey, USA).
Briefly, for each SNP, a set of three primers was designed: two PCR primers were selected to amplify a 100-200 base pair product under standard conditions and a single-base primer extension (SBE) primer was designed to be approximately 25 bp in length on one side of the SNP site. Automated liquid handling robotics was used to set up 5 µL PCR reactions in 384-well plates. Each PCR reaction contained: 10.0 ng of DNA, 1X PCR buffer, 0.125 units of AmpliTaq Gold DNA polymerase (ABI, USA), 3.0 mM MgCl2, 0.25 mM of each dNTP, and 0.5 pmol of each primer. Reactions were incubated at 95℃ for 10 min, then cycled 35 times at (95℃ for 30 s, 50, 55 or 60℃ for 1 min, 72℃ for 1 min) followed by 72℃ for 5 min. An annealing temperature of 50, 55 or 60℃ was chosen as appropriate. The primer sequences are shown in Table 1.
The amplified PCR products were digested with T7 exonuclease (0.45 U/µL) at room temperature for 30 min. The 5' phosphothioates on one of the PCR primers protected one strand of the PCR product from T7 exonuclease digestion, resulting in the generation of a single-stranded PCR product. The single-stranded PCR product was hybridized to a 384-well plate that contained a covalently attached SNP-IT™ primer extension primer designed to hybridize immediately adjacent to the SNP. After hybridization, the SNP-IT™ primer was extended for a single base with the Klenow fragment of DNA polymerase I and a mixture of appropriately labeled terminating nucleotides, which were labeled with either FITC or biotin and were complementary to the SNP. The identity of the incorporated nucleotide was determined using serial colorimetric reactions with anti-FITC-AP (alkaline phosphatase) and streptavidin-HRP (horseradish peroxidase) using p-nitrophenyl phosphate (PNPP) and tetramethylbenzidine (TMB) as a substrate respectively.
The results of yellow and/or blue color developments for each sample (wells) were analyzed in an ELISA reader and the final genotype calls were automatically assigned using the QCReview™ program (Orchid Biosciences). Automated genotype calls were corroborated by visual inspection of the data.
Statistical analyses
The chi-square test was used to identify departures from the Hardy-Weinberg equilibrium among the controls. To estimate the relative risk of schizophrenia in relation to SNP genotype, odds ratios (ORs) and 95% confidence intervals (CIs) were calculated using unconditional logistic regression. The homozygote of the most common allele in the subjects was used as the reference and a p value <0.05 was considered statistically significant.
Stratified analyses were also conducted to evaluate whether the association between the SNPs and schizophrenia risk was derived from the different ages and genders. All statistical analyses were performed using SAS version 9.1 (SAS Inc., Cary, NC, USA).
The distribution of age and gender was similar between cases and controls. The mean age was 38.3±3.9 in the cases, and 38.3±5.5 in the controls. The proportion of male subjects was 55% and 56% for cases and controls, respectively (data not shown). All genotype frequencies of the four SNPs, COMT Val158Met (rs4680), rs165599 and MTHFR C677T (rs1801133), and A1298C (rs1801131), were consistent with the Hardy-Weinberg equilibrium in the control group (p>0.05). As shown in Table 2, the genotype frequencies of the COMT Val158Met and rs165599 did not differ between the patients and controls. Likewise, the genotype frequencies of the MTHFR C677T and A1298C did not differ between the patients and controls.
No association was found either in the stratified analyses by gender-difference (Table 3), or in the analyses of combined genotypes (Table 4). In addition, we found no evidence of an interactive effect between COMT Val158Met and MTHFR C677T in the patients and controls (Table 5).
In our study, no association was found between the four functional SNPs in COMT and MTHFR, and schizophrenia risk in a Korean population.
Although a number of previous studies have evaluated the association between SNPs in the COMT gene, particularly a well-known polymorphism at COMT Val158Met termed rs4680, and schizophrenia, the results have been inconsistent and recent meta-analyses found no evidence for a relationship between COMT and schizophrenia [5-7, 25]. Several reports suggest an association with the highly active Val allele [3, 26], but many other studies have found no significant association [6, 27-29]. In our results, the COMT Val158Met genotype frequency was founded by 53.9% for GG (Val), 38.6% for GA (Val/Met) and 7.5% for AA (Met) in schizophrenia. These frequencies did not differ significantly with control subjects (55.2% for GG, 37.9% for GA and 6.9% for AA). This results were similar with that of previous studies conducted on Korean populations (schizophrenia: 61% for GG, 31% for GA and 7% for AA; Control: 52% for GG, 39% for GA and 9% for AA) [30]. And the no significant association for this SNP with schizophrenia was similar among several Asian subjects but very different among several European subjects [6, 31-33]. Overall, the Val allele may be a small risk factor for schizophrenia in European populations, while case-control studies have shown no association between Val158Met and schizophrenia in Asian populations, and thus the results remain inconclusive.
Another candidate polymorphism in the 3'-flanking region (rs165599) was not associated with schizophrenia risk in our study. The 3'-flanking region of SNP rs165599 exhibited significant allelic differences in expression in the human brain, and the A allele in schizophrenia patients is associated with higher expression of the COMT gene [9]. A previous study by Chien et al. [34] reported that rs165599 was associated with a family study, but there was no significant association in a case-control study. Okochi et al. [25] reported that there was no association between four major functional SNPs (rs2075507, rs737865, rs6267 and rs165599) and schizophrenia in a Japanese population. Therefore, these results indicate that the Val/Met polymorphism and three other functional SNPs may not play a major role in schizophrenia.
In addition, Roffman et al. [35] reported that there was contributed to the lack of association between Val158Met and rs165599 and schizophrenia, which may have gender-specific differences, as there is a stronger association of the G (Val) allele with schizophrenia in females [8]. Meyer-Lindenberg et al. found that the Val158Met genotype involved an interaction between rs2097603 at the P2 promoter region and rs165599 in the 3'-flanking region. These interactions have been implicated in an inefficient prefrontal working memory response during a working memory paradigm in healthy control subjects [36]. In our analysis of the combination of COMT Val158-Met and rs165599, we found no interactive effect in the patients and control subjects.
A number of studies including a meta-analysis have suggested an association between schizophrenia and MTHFR C677T, and A1298C and schizophrenia [15-17]. Zintzaras reported that the C677T association was only of marginal significance in an East Asian population, with a fixed effects odds ratio of 1.23 (1.00-1.52), whereas for Caucasians the results were non-significant [18]. However, there was no association between two MTHFR functional SNPs and schizophrenia risk in our study. Such inconsistent results may be due to the ethnic diversity in terms of allele frequency and exposure to environmental factors, warranting further studies.
Finally, we also carried out an association analysis on the effect of two genetic variants of enzymes of the methylation pathway, the COMT Val158Met and MTHFR C677T polymorphisms, on schizophrenia risk. MTHFR C677T may contribute to COMT gene regulation, wherein T-allele carriers exhibit diminished promoter methylation, increased COMT expression, and reduced dopamine signaling [22]. Roffman et al. reported that the MTHFR T allele undermines category generation in schizophrenia, with 33% of T/T patients unable to complete a single category, and then reported that COMT Val108/158Met does not significantly influence this aspect of executive function, by itself or in interaction with MTHFR C677T [35, 37]. However, that study had several limitations such as the number of subjects, especially for a gene interaction study, and the results require replication in other samples. Our study revealed that no association between COMT 158Val genotype combined with the MTHFR 677TT within patient and controls. Therefore, the genetic interaction of the COMT Val158Met and MTHFR C677T genotype may contribute to executive function deficits in schizophrenia [37].
The limitations of our study include the small sample size, the lack of sub-classification of schizophrenia, and the lack of adjustment for potential confounders. Our study had a power of >70% in each gene to detect an odds ratio of ≥1.5 (assuming a dominant effect, with a minor allele frequency of 0.1 and α=0.05). However, we note that further studies are required on a larger number of subjects and compressive approach for the COMT and MTHFR genes in the Korean population.
In conclusion, our results suggest no significant association between any of the selected functional polymorphisms of COMT or MTHFR in Korean schizophrenia subjects. However, further studies are required to confirm our findings in a larger number of subjects.

The authors have no conflict of interest to declare on this study.

This article is available from: http://e-epih.org/.

  • 1. Tsuang M. Schizophrenia: genes and environment. Biol Psychiatry 2000;47:210-220. 10682218.ArticlePubMed
  • 2. Owen MJ, O'Donovan MC, Gottesman II. In: Mc-Guffin P, Owen MJ, Gottesman II, eds. Schizophrenia. Psychiatric genetics & genomics. 2002. Oxford: Oxford University Press; p 247-266.ArticlePubMedPMC
  • 3. Egan MF, Goldberg TE, Kolachana BS, Callicott JH, Mazzanti CM, Straub RE, et al. Effect of COMT Val108/158Met genotype on frontal lobe function and risk for schizophrenia. Proc Natl Acad Sci USA 2001;98:6917-6922. 11381111.ArticlePubMedPMC
  • 4. Joober R, Gauthier J, Lal S, Bloom D, Lalonde P, Rouleau G, et al. Catechol-O-methyltransferase Val-108/158-Met gene variants associated with performance on the Wisconsin Card Sorting Test. Arch Gen Psychiatry 2002;59:662-663. 12090821.ArticlePubMed
  • 5. Barnett JH, Jones PB, Robbins TW, Müller U. Effects of the catechol-O-methyltransferase Val158Met polymorphism on executive function: a meta-analysis of the Wisconsin Card Sort Test in schizophrenia and healthy controls. Mol Psychiatry 2007;12:502-509. 17325717.ArticlePubMed
  • 6. Fan JB, Zhang CS, Gu NF, Li XW, Sun WW, Wang HY, et al. Catechol-O-methyltransferase gene Val/Met functional polymorphism and risk of schizophrenia: a large-scale association study plus metaanalysis. Biol Psychiatry 2005;57:139-144. 15652872.ArticlePubMed
  • 7. Munafò MR, Bowes L, Clark TG, Flint J. Lack of association of the COMT (Val158/108 Met) gene and schizophrenia: a meta-analysis of case-control studies. Mol Psychiatry 2005;10:765-770. 15824744.ArticlePubMed
  • 8. Shifman S, Bronstein M, Sternfeld M, Pisanté-Shalom A, Lev-Lehman E, Weizman A, et al. A highly significant association between a COMT haplotype and schizophrenia. Am J Hum Genet 2002;71:1296-1302. 12402217.ArticlePubMedPMC
  • 9. Bray NJ, Buckland PR, Williams NM, Williams HJ, Norton N, Owen MJ, et al. A haplotype implicated in schizophrenia susceptibility is associated with reduced COMT expression in human brain. Am J Hum Genet 2003;73:152-161. 12802784.ArticlePubMedPMC
  • 10. Goyette P, Sumner JS, Milos R, Duncan AM, Rosenblatt DS, Matthews RG, et al. Human methylenetetrahydrofolate reductase: isolation of cDNA, mapping and mutation identification. Nat Genet 1994;7:195-200. 7920641.ArticlePubMed
  • 11. van der Put NM, Gabreëls F, Stevens EM, Smeitink JA, Trijbels FJ, Eskes TK, et al. A second common mutation in the methylenetetrahydrofolate reductase gene: an additional risk factor for neural-tube defects? Am J Hum Genet 1998;62:1044-1051. 9545395.ArticlePubMedPMC
  • 12. Lievers KJ, Boers GH, Verhoef P, den Heijer M, Kluijtmans LA, van der Put NM, et al. A second common variant in the methylenetetrahydrofolate reductase (MTHFR) gene and its relationship to MTHFR enzyme activity, homocysteine, and cardiovascular disease risk. J Mol Med 2001;79:522-528. 11692165.ArticlePubMed
  • 13. Frosst P, Blom HJ, Milos R, Goyette P, Sheppard CA, Matthews RG, et al. A candidate genetic risk factor for vascular disease: a common mutation in methylenetetrahydrofolate reductase. Nat Genet 1995;10:111-113. 7647779.ArticlePubMed
  • 14. Friso S, Choi SW, Girelli D, Mason JB, Dolnikowski GG, Bagley PJ, et al. A common mutation in the 5,10-methylenetetrahydrofolate reductase gene affects genomic DNA methylation through an interaction with folate status. Proc Natl Acad Sci USA 2002;99:5606-5611. 11929966.ArticlePubMedPMC
  • 15. Gilbody S, Lewis S, Lightfoot T. Methylenetetrahydrofolate reductase (MTHFR) genetic polymorphisms and psychiatric disorders: a HuGE review. Am J Epidemiol 2007;165:1-13. 17074966.ArticlePubMed
  • 16. Lewis SJ, Zammit S, Gunnell D, Smith GD. A meta-analysis of the MTHFR C677T polymorphism and schizophrenia risk. Am J Med Genet B Neuropsychiatr Genet 2005;135B:2-4. 15729744.Article
  • 17. Muntjewerff JW, Kahn RS, Blom HJ, den Heijer M. Homocysteine, methylenetetrahydrofolate reductase and risk of schizophrenia: a meta-analysis. Mol Psychiatry 2006;11:143-149. 16172608.ArticlePubMed
  • 18. Zintzaras E. C677T and A1298C methylenetetrahydrofolate reductase gene polymorphisms in schizophrenia, bipolar disorder and depression: a meta-analysis of genetic association studies. Psychiatr Genet 2006;16:105-115. 16691128.ArticlePubMed
  • 19. Mudd SH, Levy HL, Kraus JP. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. Disorders of transsulfuration. The metabolic and molecular bases of inherited disease. 2001. New York: McGraw-Hill; p 2007-2056.
  • 20. Sasaki M, Kaneuchi M, Sakuragi N, Dahiya R. Multiple promoters of catechol-O-methyltransferase gene are selectively inactivated by CpG hypermethylation in endometrial cancer. Cancer Res 2003;63:3101-3106. 12810635.ArticlePubMed
  • 21. Abdolmaleky HM, Cheng KH, Faraone SV, Wilcox M, Glatt SJ, Gao F, et al. Hypomethylation of MB-COMT promoter is a major risk factor for schizophrenia and bipolar disorder. Hum Mol Genet 2006;15:3132-3145. 16984965.ArticlePubMedPMC
  • 22. Deth RC. Molecular origins of human attention: the dopamine-folate connection. 2003. New York: Springer-Verlag.
  • 23. Andreasen NC, Flaum M, Arndt S. The Comprehensive Assessment of Symptoms and History (CASH). An instrument for assessing diagnosis and psychopathology. Arch Gen Psychiatry 1992;49:615-623. 1637251.ArticlePubMed
  • 24. American Psychiatric Association. Diagnostic and statistical manual of mental disorders. 1994. Washington DC: American Psychiatric Press.
  • 25. Okochi T, IKeda M, Kishi T, Kawashima K, Kinoshita Y, Kitajima T, et al. Meta-analysis of association between genetic variants in COMT and schizophrenia: an update. Schizophr Res 2009;110:140-148. 19329282.ArticlePubMed
  • 26. Kremer I, Pinto M, Murad I, Muhaheed M, Bannoura I, Muller DJ, et al. Family-based and case-control study of catechol-O-methyltransferase in schizophrenia among Palestinian Arabs. Am J Med Genet B Neuropsychiatr Genet 2003;119B:35-39. 12707935.Article
  • 27. Arinami T, Ohtsuki T, Takase K, Shimizu H, Yoshikawa T, Horigome H, et al. Screening for 22q11 deletions in a schizophrenia population. Schizophr Res 2001;52:167-170. 11705710.ArticlePubMed
  • 28. Galderisi S, Maj M, Kirkpatrick B, Piccardi P, Mucci A, Invernizzi G, et al. COMT Val (158)Met and BDNF C (270)T polymorphisms in schizophrenia: a case-control study. Schizophr Res 2005;73:27-30. 15567073.ArticlePubMed
  • 29. Norton N, Kirov G, Zammit S, Jones G, Jones S, Owen R, et al. Schizophrenia and functional polymorphisms in the MAOA and COMT genes: no evidence for association or epistasis. Am J Med Genet 2002;114:491-496. 12116182.ArticlePubMed
  • 30. Kim YR, Kim JH, Kim SJ, Lee D, Min SK. Catechol-O-methyltransferase Val158Met polymorphism in relation to aggressive schizophrenia in a Korean population. Eur Neuropsychopharmacol 2008;18:820-825. 18789857.ArticlePubMed
  • 31. Liou YJ, Tsai SJ, Hong CJ, Wang YC, Lai IC. Association analysis of a functional catechol-o-methyltransferase gene polymorphism in schizophrenic patients in Taiwan. Neuropsychobiology 2001;43:11-14. 11150892.ArticlePubMed
  • 32. Nunokawa A, Watanabe Y, Muratake T, Kaneko N, Koizumi M, Someya T. No associations exist between five functional polymorphisms in the catechol-O-methyltransferase gene and schizophrenia in a Japanese population. Neurosci Res 2007;58:291-296. 17482701.ArticlePubMed
  • 33. Palmatier MA, Pakstis AJ, Speed W, Paschou P, Goldman D, Odunsi A, et al. COMT haplotypes suggest P2 promoter region relevance for schizophrenia. Mol Psychiatry 2004;9:859-870. 15098000.ArticlePubMed
  • 34. Chien YL, Liu CM, Fann CS, Liu YL, Hwu HG. Association of the 3' region of COMT with schizophrenia in Taiwan. J Formos Med Assoc 2009;108:301-309. 19369177.ArticlePubMed
  • 35. Roffman JL, Weiss AP, Deckersbach T, Freudenreich O, Henderson DC, Purcell S, et al. Effects of the methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism on executive function in schizophrenia. Schizophr Res 2007;92:181-188. 17344026.ArticlePubMed
  • 36. Meyer-Lindenberg A, Nichols T, Callicott JH, Ding J, Kolachana B, Buckholtz J, et al. Impact of complex genetic variation in COMT on human brain function. Mol Psychiatry 2006;11:867-877. 16786032.ArticlePubMed
  • 37. Roffman JL, Weiss AP, Deckersbach T, Freudenreich O, Henderson DC, Wong DH, et al. Interactive effects of COMT Val108/158Met and MTHFR C677T on executive function in schizophrenia. Am J Med Genet B Neuropsychiatr Genet 2008;147B:990-995. 18186041.Article
Table 1
Primer sequences for genotyping
Genes SNPs Primers Sequences (5'→3') Annealing temp (c )
COMT rs4680 (Val158Met) Forward ATCAACCCCGACTGTGCC 55
Reverse CTTTTTCCAGGTCTGACAACG
Extension 5'FAM -GCGGATGGTGGATTTCGCTGGC
rs165599 (3'-fianking region) Forward TCCTGCAGCTAGGCCAGG 55
Reverse AGAAAGGTGTGAATGCTGG
Extension 5'FAM -GCTGACTCCTCTTCGTTTCCCAGGC
MTHFR rs1801133 (C677T) Forward AAGCAGGGAGCTTTGAGGC 55
Reverse CAAGTGATGCCCATGTCG
Extension 5'FAM -GAAAAGCTGCGTGATGATGAAATCG
rs1801131 (A1298C) Forward AAGGAGGAGCTGCTGAAGA 55
Reverse TTTGTGACCATTCCGGTT
Extension 5'FAM -TAAAGAACAAAGACTTCAAAGACACTT

COMT, catechol-O-methyltransferase; MTHFR, methylenetetrahydrofolate reductase.

Table 2
Genotype frequencies of selected polymorphisms in COMT and MTHFR among cases and controls
Genes SNPs Genotype N (%)
OR 95% CI p-value
Controls (n=348)
Patients (n=360)
n % n %
COMT rs4680 GG 192 55.2 194 53.9 1.00* - - -
GA 132 37.9 139 38.6 1.04 0.76 1.42 0.79
AA 24 6.9 27 7.5 1.11 0.62 2.00 0.72
rs165599 GG 76 21.8 66 18.3 1.00* - - -
GA 160 46.0 184 51.1 1.32 0.89 1.96 0.16
AA 112 32.2 110 30.6 1.13 0.74 1.72 0.57
MTHFR rs1801133 CC 130 37.4 125 34.7 1.00* - - -
CT 158 45.4 176 48.9 1.16 0.84 1.61 0.38
TT 60 17.2 59 16.4 1.02 0.66 1.60 0.92
rs1801131 AA 239 68.7 248 68.9 1.00* - - -
CA 100 28.7 105 29.2 1.01 0.73 1.40 0.94
CC 9 2.6 7 1.9 0.75 0.28 2.05 0.57

OR, odds ratio; CI, confidence interval; COMT, catechol-O-methyltransferase; MTHFR, methylenetetrahydrofolate reductase.

*Reference category, OR=1.

Table 3
Stratified analysis by gender for the association between selected polymorphisms in COMT and MTHFR and schizophrenia risk
Genes SNPs Sex Genotype N (%)
OR 95% CI p-vaiue
Controls (n=348)
Patients (n=360)
n % n %
COMT rs4680 Male GG 114 58.2 105 53.8 1.00* - - -
GA 66 33.7 75 38.5 1.23 0.81 1.86 0.33
AA 16 8.2 15 7.7 1.02 0.49 2.16 0.96
rs165599 GG 40 20.4 35 17.9 1.00* - - -
GA 86 43.9 107 54.9 1.42 0.83 2.43 0.18
AA 70 35.7 53 27.2 0.87 0.49 1.54 0.62
MTHFR rs1801133 CC 79 40.3 71 36.4 1.00* - - -
CT 81 41.3 88 45.1 1.21 0.78 1.88 0.40
TT 36 18.4 36 18.5 1.11 0.63 1.95 0.71
rs1801131 AA 134 68.4 140 71.8 1.00* - - -
CA 58 29.6 51 26.2 0.84 0.54 1.31 0.45
CC 4 2.0 4 2.1 0.96 0.24 3.91 0.95
COMT rs4680 Female GG 78 51.3 89 54.3 1.00* - - -
GA 66 43.4 63 38.4 0.84 0.53 1.33 0.45
AA 8 5.3 12 7.3 1.32 0.51 3.38 0.57
rs165599 GG 36 23.7 30 18.3 1.00* - - -
GA 74 48.7 77 47.0 1.25 0.70 2.23 0.45
AA 42 27.6 57 34.8 1.63 0.88 3.05 0.13
MTHFR rs1801133 CC 51 33.6 54 32.9 1.00* - - -
CT 77 50.7 87 53.0 1.07 0.65 1.74 0.80
TT 24 15.8 23 14.0 0.91 0.46 1.80 0.78
rs1801131 AA 105 69.1 107 65.2 1.00* - - -
CA 42 27.6 54 32.9 1.26 0.78 2.05 0.35
CC 5 3.3 3 1.8 0.59 0.14 2.53 0.48

OR, odds ratio; CI, confidence interval; COMT, catechol-O-methyltransferase; MTHFR, methylenetetrahydrofolate reductase.

*Reference category, OR=1.

Table 4
Distribution of combined genotypes of COMT Val158Met, rs165599 and MTHFR C677T, A1298C among cases and controls
Genes Genotype N (%)
OR 95% CI p-vaiue
Controis (n=348) Patients (n=360)
COMT rs4680 rs165599 n % n %

Vai GG 65 33.9 57 29.4 1.00* - - -
GA 85 44.3 100 51.5 1.34 0.85 2.12 0.20
AA 42 21.9 37 19.1 1.01 0.57 1.77 0.99
Met carrier GG 11 7.1 9 5.4 1.00* - - -
GA 75 48.1 84 50.6 1.37 0.54 3.48 0.51
AA 70 44.9 73 44.0 1.27 0.50 3.26 0.61

MTHFR rs1801133 rs1801131 n % n %

CC AA 72 55.4 63 50.4 1.00* - - -
CA 50 38.5 55 44.0 1.26 0.75 2.10 0.38
CC 8 6.2 7 5.6 1.00 0.34 2.91 1.00
CT+TT AA 167 76.6 185 78.7 1.00* - - -
CA 50 22.9 50 21.3 0.90 0.58 1.41 0.65
CC 1 0.5 0 0 - - - -

OR, odds ratio; CI, confidence interval; COMT, catechol-O-methyltransferase; MTHFR, methylenetetrahydrofolate reductase.

*Reference category, OR=1, Val genotype; GG, Met carrier genotype; GA+AA.

Table 5
Interactive effects between COMT Val158Met and MTHFR C677T on schizophrenia risk
Genes MTHFRrs1801133 N (%)
OR 95% CI p-vaiue
Controis (n=348)
Patients (n=360)
n % n %
COMT Vai CC 69 35.9 62 32.0 1.00* - - -
 rs4680 CT 97 50.5 100 51.5 1.15 0.74 1.79 0.54
TT 26 13.5 32 16.5 1.37 0.74 2.55 0.32
Met carrier CC 61 39.1 63 38.0 1.00* - - -
CT 61 39.1 76 45.8 1.21 0.74 1.96 0.45
TT 34 21.8 27 16.3 0.77 0.42 1.42 0.40

OR, odds ratio; CI, confidence interval; COMT, catechol-O-methyltransferase; MTHFR, methylenetetrahydrofolate reductase.

*Reference category, OR=1, Val genotype; GG, Met carrier genotype; GA+AA.

Figure & Data

References

    Citations

    Citations to this article as recorded by  
    • Molecular Mechanisms Provide a Landscape for Biomarker Selection for Schizophrenia and Schizoaffective Psychosis
      Stephanie Fryar-Williams, Jörg Strobel, Peter Clements
      International Journal of Molecular Sciences.2023; 24(20): 15296.     CrossRef
    • Association between MTHFR (677C>T and 1298A>C) polymorphisms and psychiatric disorder: A meta-analysis
      Xinyao Meng, Ji-long Zheng, Mao-ling Sun, Hai-yun Lai, Bao-jie Wang, Jun Yao, Hongbo Wang, Zezhi Li
      PLOS ONE.2022; 17(7): e0271170.     CrossRef
    • Association between variants of MTHFR genes and psychiatric disorders: A meta-analysis
      Yu-Xin Zhang, Lu-Ping Yang, Cong Gai, Cui-Cui Cheng, Zhen-yu Guo, Hong-Mei Sun, Die Hu
      Frontiers in Psychiatry.2022;[Epub]     CrossRef
    • MTHFR Ala222Val polymorphism and clinical characteristics confer susceptibility to suicide attempt in chronic patients with schizophrenia
      Jia Hong Liu, Cheng Zhu, Ke Zheng, Wei Tang, Li Li Gao, Tammy H. Trihn, Hanjing Emily Wu, Da Chun Chen, Mei Hong Xiu, Xiang Yang Zhang
      Scientific Reports.2020;[Epub]     CrossRef
    • Effort-related decision making in humanized COMT mice: Effects of Val158Met polymorphisms and possible implications for negative symptoms in humans
      Jen-Hau Yang, Rose E. Presby, Suzanne Cayer, Renee A. Rotolo, Peter A. Perrino, R. Holly Fitch, Merce Correa, Elissa J. Chesler, John D. Salamone
      Pharmacology Biochemistry and Behavior.2020; 196: 172975.     CrossRef
    • Association of functional polymorphisms in 3′-untranslated regions of COMT, DISC1, and DTNBP1 with schizophrenia
      Zahra I. Mohamed, Shiau F. Tee, Pek Y. Tang
      Psychiatric Genetics.2018; 28(6): 110.     CrossRef
    • Methylenetetrahydrofolate reductase A1298C genetic variant & risk of schizophrenia
      Vandana Rai, Upendra Yadav, Pradeep Kumar, Sushil K. Yadav, Sanjay Gupta
      Indian Journal of Medical Research.2017; 145(4): 437.     CrossRef
    • Role of MTHFR C677T gene polymorphism in the susceptibility of schizophrenia: An updated meta-analysis
      Upendra Yadav, Pradeep Kumar, Sanjay Gupta, Vandana Rai
      Asian Journal of Psychiatry.2016; 20: 41.     CrossRef
    • The Role of a Catechol-O-Methyltransferase (COMT) Val158Met Genetic Polymorphism in Schizophrenia: A Systematic Review and Updated Meta-analysis on 32,816 Subjects
      Thelma Beatriz González-Castro, Yazmin Hernández-Díaz, Isela Esther Juárez-Rojop, María Lilia López-Narváez, Carlos Alfonso Tovilla-Zárate, Ana Fresan
      NeuroMolecular Medicine.2016; 18(2): 216.     CrossRef
    • Evaluation of an association between plasma total homocysteine and schizophrenia by a Mendelian randomization analysis
      Shusuke Numata, Makoto Kinoshita, Atsushi Tajima, Akira Nishi, Issei Imoto, Tetsuro Ohmori
      BMC Medical Genetics.2015;[Epub]     CrossRef
    • Catechol-O-methyltransferase gene polymorphisms in Saudi cases with schizophrenia
      Ashraf Tantawy, Abduhamid Al-Yahia, Yasser Raya, Abdurrahman Al-Mohaimeed, Ahmad Settin
      Egyptian Journal of Psychiatry.2015; 36(3): 118.     CrossRef
    • Association of MTHFR C677T polymorphism with schizophrenia and its effect on episodic memory and gray matter density in patients
      Yanling Zhang, Hao Yan, Lin Tian, Fang Wang, Tianlan Lu, Lifang Wang, Jun Yan, Qi Liu, Lan Kang, Yanyan Ruan, Dai Zhang, Weihua Yue
      Behavioural Brain Research.2013; 243: 146.     CrossRef
    • Genetic Variation Throughout the Folate Metabolic Pathway Influences Negative Symptom Severity in Schizophrenia
      J. L. Roffman, D. G. Brohawn, A. Z. Nitenson, E. A. Macklin, J. W. Smoller, D. C. Goff
      Schizophrenia Bulletin.2013; 39(2): 330.     CrossRef
    • No Association of Functional Polymorphisms in Methlylenetetrahydrofolate Reductase and the Risk and Minor Physical Anomalies of Schizophrenia in Korean Population
      Su-Gyeong Kim, Joo Yun Song, Eun-Jeong Joo, Seong Hoon Jeong, Se Hyun Kim, Kyu Young Lee, Nam Young Lee, Yong Min Ahn, Yong Sik Kim, Myoung-Sun Roh
      Journal of Korean Medical Science.2011; 26(10): 1356.     CrossRef

    Related articles
    No Association Between Functional Polymorphisms in COMT and MTHFR and Schizophrenia Risk in Korean Population
    No Association Between Functional Polymorphisms in COMT and MTHFR and Schizophrenia Risk in Korean Population
    Genes SNPs Primers Sequences (5'→3') Annealing temp (c )
    COMT rs4680 (Val158Met) Forward ATCAACCCCGACTGTGCC 55
    Reverse CTTTTTCCAGGTCTGACAACG
    Extension 5'FAM -GCGGATGGTGGATTTCGCTGGC
    rs165599 (3'-fianking region) Forward TCCTGCAGCTAGGCCAGG 55
    Reverse AGAAAGGTGTGAATGCTGG
    Extension 5'FAM -GCTGACTCCTCTTCGTTTCCCAGGC
    MTHFR rs1801133 (C677T) Forward AAGCAGGGAGCTTTGAGGC 55
    Reverse CAAGTGATGCCCATGTCG
    Extension 5'FAM -GAAAAGCTGCGTGATGATGAAATCG
    rs1801131 (A1298C) Forward AAGGAGGAGCTGCTGAAGA 55
    Reverse TTTGTGACCATTCCGGTT
    Extension 5'FAM -TAAAGAACAAAGACTTCAAAGACACTT
    Genes SNPs Genotype N (%)
    OR 95% CI p-value
    Controls (n=348)
    Patients (n=360)
    n % n %
    COMT rs4680 GG 192 55.2 194 53.9 1.00* - - -
    GA 132 37.9 139 38.6 1.04 0.76 1.42 0.79
    AA 24 6.9 27 7.5 1.11 0.62 2.00 0.72
    rs165599 GG 76 21.8 66 18.3 1.00* - - -
    GA 160 46.0 184 51.1 1.32 0.89 1.96 0.16
    AA 112 32.2 110 30.6 1.13 0.74 1.72 0.57
    MTHFR rs1801133 CC 130 37.4 125 34.7 1.00* - - -
    CT 158 45.4 176 48.9 1.16 0.84 1.61 0.38
    TT 60 17.2 59 16.4 1.02 0.66 1.60 0.92
    rs1801131 AA 239 68.7 248 68.9 1.00* - - -
    CA 100 28.7 105 29.2 1.01 0.73 1.40 0.94
    CC 9 2.6 7 1.9 0.75 0.28 2.05 0.57
    Genes SNPs Sex Genotype N (%)
    OR 95% CI p-vaiue
    Controls (n=348)
    Patients (n=360)
    n % n %
    COMT rs4680 Male GG 114 58.2 105 53.8 1.00* - - -
    GA 66 33.7 75 38.5 1.23 0.81 1.86 0.33
    AA 16 8.2 15 7.7 1.02 0.49 2.16 0.96
    rs165599 GG 40 20.4 35 17.9 1.00* - - -
    GA 86 43.9 107 54.9 1.42 0.83 2.43 0.18
    AA 70 35.7 53 27.2 0.87 0.49 1.54 0.62
    MTHFR rs1801133 CC 79 40.3 71 36.4 1.00* - - -
    CT 81 41.3 88 45.1 1.21 0.78 1.88 0.40
    TT 36 18.4 36 18.5 1.11 0.63 1.95 0.71
    rs1801131 AA 134 68.4 140 71.8 1.00* - - -
    CA 58 29.6 51 26.2 0.84 0.54 1.31 0.45
    CC 4 2.0 4 2.1 0.96 0.24 3.91 0.95
    COMT rs4680 Female GG 78 51.3 89 54.3 1.00* - - -
    GA 66 43.4 63 38.4 0.84 0.53 1.33 0.45
    AA 8 5.3 12 7.3 1.32 0.51 3.38 0.57
    rs165599 GG 36 23.7 30 18.3 1.00* - - -
    GA 74 48.7 77 47.0 1.25 0.70 2.23 0.45
    AA 42 27.6 57 34.8 1.63 0.88 3.05 0.13
    MTHFR rs1801133 CC 51 33.6 54 32.9 1.00* - - -
    CT 77 50.7 87 53.0 1.07 0.65 1.74 0.80
    TT 24 15.8 23 14.0 0.91 0.46 1.80 0.78
    rs1801131 AA 105 69.1 107 65.2 1.00* - - -
    CA 42 27.6 54 32.9 1.26 0.78 2.05 0.35
    CC 5 3.3 3 1.8 0.59 0.14 2.53 0.48
    Genes Genotype N (%)
    OR 95% CI p-vaiue
    Controis (n=348) Patients (n=360)
    COMT rs4680 rs165599 n % n %

    Vai GG 65 33.9 57 29.4 1.00* - - -
    GA 85 44.3 100 51.5 1.34 0.85 2.12 0.20
    AA 42 21.9 37 19.1 1.01 0.57 1.77 0.99
    Met carrier GG 11 7.1 9 5.4 1.00* - - -
    GA 75 48.1 84 50.6 1.37 0.54 3.48 0.51
    AA 70 44.9 73 44.0 1.27 0.50 3.26 0.61

    MTHFR rs1801133 rs1801131 n % n %

    CC AA 72 55.4 63 50.4 1.00* - - -
    CA 50 38.5 55 44.0 1.26 0.75 2.10 0.38
    CC 8 6.2 7 5.6 1.00 0.34 2.91 1.00
    CT+TT AA 167 76.6 185 78.7 1.00* - - -
    CA 50 22.9 50 21.3 0.90 0.58 1.41 0.65
    CC 1 0.5 0 0 - - - -
    Genes MTHFRrs1801133 N (%)
    OR 95% CI p-vaiue
    Controis (n=348)
    Patients (n=360)
    n % n %
    COMT Vai CC 69 35.9 62 32.0 1.00* - - -
     rs4680 CT 97 50.5 100 51.5 1.15 0.74 1.79 0.54
    TT 26 13.5 32 16.5 1.37 0.74 2.55 0.32
    Met carrier CC 61 39.1 63 38.0 1.00* - - -
    CT 61 39.1 76 45.8 1.21 0.74 1.96 0.45
    TT 34 21.8 27 16.3 0.77 0.42 1.42 0.40
    Table 1 Primer sequences for genotyping

    COMT, catechol-O-methyltransferase; MTHFR, methylenetetrahydrofolate reductase.

    Table 2 Genotype frequencies of selected polymorphisms in COMT and MTHFR among cases and controls

    OR, odds ratio; CI, confidence interval; COMT, catechol-O-methyltransferase; MTHFR, methylenetetrahydrofolate reductase.

    *Reference category, OR=1.

    Table 3 Stratified analysis by gender for the association between selected polymorphisms in COMT and MTHFR and schizophrenia risk

    OR, odds ratio; CI, confidence interval; COMT, catechol-O-methyltransferase; MTHFR, methylenetetrahydrofolate reductase.

    *Reference category, OR=1.

    Table 4 Distribution of combined genotypes of COMT Val158Met, rs165599 and MTHFR C677T, A1298C among cases and controls

    OR, odds ratio; CI, confidence interval; COMT, catechol-O-methyltransferase; MTHFR, methylenetetrahydrofolate reductase.

    *Reference category, OR=1, Val genotype; GG, Met carrier genotype; GA+AA.

    Table 5 Interactive effects between COMT Val158Met and MTHFR C677T on schizophrenia risk

    OR, odds ratio; CI, confidence interval; COMT, catechol-O-methyltransferase; MTHFR, methylenetetrahydrofolate reductase.

    *Reference category, OR=1, Val genotype; GG, Met carrier genotype; GA+AA.


    Epidemiol Health : Epidemiology and Health
    TOP